Articles / Статьи

Polikanova I.S., Korshunov A.V., Leonov S.V., Veraksa A.N. (2016). Association to dopamine receptor D2 (DRD2) with developing fatigue as a result of long-term cognitive load. National Psychological Journal. 3, 115-126. / Поликанова И.С., Коршунов А.В., Леонов С.В., Веракса А.Н. Ассоциация рецептора к дофамину второго типа (DRD2) с развитием утомления в результате длительной когнитивной нагрузки. // Национальный психологический журнал. – 2016. – № 3(23). – С. 115-126.

В многочисленных исследовани­ях (Newsholme, 1992, 1995; Davis, 1997, 2000; Salamone et al, 1999, 2010a, 2010b; Blomstrand, 2001; Nieoullon, 2002; Lorist et al, 2005; Fernstrom, 2006; Meeusen R, 2007; Gosso, 2008; Foley et al., 2008; Malyuchenko N et al., 2009; Bolton, 2010; Barnes, 2011; Polikanova I.S.et al, 2012; Khaustova et al, 2010; Shkurnikov et al, 2008; Зинченко и др., 2011) была по­казана связь между утомлением и уровнем концентрации определенных нейромеди­аторов, преимущественно с дофамином и серотонином. Определенный уровень концентрации данных нейромедиаторов зависит от наличия тех или иных полиморфизмов, связанных с транспортировкой, удалением этих нейромедиаторов, а также с плотностью рецепторов для них.

Многие ученые сходятся в том, что дофаминергическая система играет важ­ную роль в формировании когнитив­ной сферы человека. В настоящее время проводится все больше научных иссле­дований, посвященных изучению гене­тических основ поведения, важную роль в котором играет дофаминергическая система мозга. Перспективными канди­датами для изучения генетической при­роды поведения являются гены, коди­рующие ключевые белки, участвующие в передаче дофаминергического сигна­ла, синтезе дофамина, его высвобожде­ния в синаптическую щель. Исследова­ния последних лет показали, что в мозге млекопитающих обнаружено несколько типов дофаминергических рецепторов. Основными типами дофаминовых ре­цепторов являются Д1- и Д2-рецепторы.Недавно были открыты также рецепто­ры ДЗ, Д4 и Д5.Рецепторы дофамина ло­кализованы как на пре-, так и на постси­наптической мембране. Предполагается, что пресинаптические ауторецепторы, принадлежащие к Д2 и Д3 подтипу, мо­гут находиться на соме, дендритах и нервных терминалях. Они принимают участие в регуляции процессов синтеза и высвобождения дофамина во внекле­точное пространство. Для постсинапти­ческих (Д1, Д4, Д5) рецепторов харак­терна локализация не только в области синаптического контакта, но и в значительном удалении от нее, что говорит о возможном действии медиатора вне си­наптических терминалий.

Рецептор дофамина второго типа (DRD2, Д2-рецептор) относится к ауторецепторам, принимающим участие в регуляции процессов синтеза и выс­вобождения дофамина во внеклеточное пространство. Стимуляция Д2-рецепто­ров приводит к торможению передачи нервного импульса в симпатических ган­глиях, снижению выделения дофамина и норадреналина из симпатических окон­чаний.Д2-рецептор ингибирует адени­латциклазу и Ca-канал, но активирует K-канал.Д2-подобные рецепторы пре­обладают в стриатуме – хвостатом ядре и скорлупе, но имеются также в поясной извилине и коре островка (Joyce, 1986).

Одним из наиболее хорошо изучен­ных полиморфизмов гена DRD2 является полиморфизм TaqIA. Он определяет плот­ность рецепторов дофамина второго типа в синаптической щели. У носителей ал­леля А1 наблюдается 30-40% уменьшения плотности этих рецепторов, по сравне­нию с плотностью рецепторов у носите­лей генотипа А2А2.Аллель А1 встречает­ся в популяции россиян с частотой 0,172, а аллель А2 – 0,828 (Kidd, 1998).

В нескольких работах было показа­но, что аллель A1 ассоциирован со сни­жением уровня дофамина в ЦНС. Также известно, что наличие аллеля A1 ведет к снижению сродства рецепторов к до­фамину (Ritchie, 2003) и к уменьшению плотности дофаминовых рецепторов второго типа в стриатуме (Thompson, 1997). Считается, что стриатум является структурой принятия решения на уров­не поведенческих реакций и одним из отделов головного мозга, отвечающих за регуляцию адаптивного поведения.

Рецептор Д2 был исследован на пред­мет ассоциации с чертами характера. Цай и соавторы обнаружили ассоциацию аллеля А1 с высоким уровнем интеллекта у женщин (Tsai, 2002). Исследования за­висимости полиморфизма TaqIA от такой черты поведения, как креативность, показали, что носители аллеля А1 обладают повышенном уровнем индекса вербаль­ной и общей креативности (Reuter, 2006). Посредством TPQ опросника было пока­зано, что у носителей аллеля А1 наблюда­ются повышенные показатели по шкале “поиска новизны“ (Kaasinen, 2004).

Исследования в области психофизи­ологии утомления показывают, что раз­личные показатели ЭЭГ коррелируют с параметрами утомления. К таким по­казателям ЭЭГ можно отнести увеличе­ние мощностей медленных ритмов (тета- и альфа-ритмов), индивидуальный аль­фа-ритм, индекс утомления. Многие ис­следования показывают общие тенденции в динамике различных параметров (субъ­ективных, поведенческих, электрофизио­логических) в условиях длительных когнитивных нагрузок. Особенности сдвигов, как правило, связаны со специфичностью выполняемых заданий. Так, многочислен­ные исследования показывают, что аль­фа-ритм хорошо видно в состоянии фи­зического и умственного расслабления (Golojahani, 2012). На ЭЭГ, зарегистриро­ванной в спокойном состоянии, обычно хорошо заметен отдельный пик на часто­те альфа ритма (8-14 Hz). Данный пара­метр имеет высокую интраиндивидуаль­ную стабильность (Binni, 2003; Fernandez, 1993), а также достаточно сильную вариацию между отдельными людьми и из­менчивость с возрастом (Klimesh, 1999) в исследовании Питерсона было показано, что у взрослого человека среднее значе­ние индивидуального альфа пика состав­ляет 10.2+/-0.9 Гц (Peterson, 1971). В целом ряде исследований показано, что альфа пик характеризуется увеличением с детст­ва до пубертата (Epstein, 1980). У взрослых людей, наоборот, альфа пик характеризу­ется уменьшением с возрастом – с 20 до 70 лет его частота уменьшается в среднем с 10,89 Гц до 8,24 Гц (Klimesh, 1997).

Различные исследования показывают, что пик альфа ритма положительно кор­релирует с успешностью выполнения ког­нитивных функций таких, как внимание, память, скоростью протекания инфор­мационных процессов (Angealakis, 2004; Klimesh, 1999). Частота индивидуального альфа ритма возрастает больше в правом полушарии при выполнении зрительных заданий и больше в левом при выполне­нии арифметических заданий (Angealakis, 2004). Климеш показал, что испытуемые со сниженными мнестическими способно­стями характеризуются снижением пика альфа ритма во время выполнения зада­ний на память, а испытуемые с высокими мнестическими способностями характе­ризуются стабильностью пика альфа рит­ма в различных условиях (Klimesh, 1993). Также Климеш показал, что испытуемые с высокими мнестическими способно­стями и высокой скоростью обработки информации характеризуются частотой альфа пика в среднем на 1 Гц большей по сравнению с контрольной группой (Klimesh, 1996, 1997). Предыдущие иссле­дования выявили, что целый ряд психи­ческих заболеваний также связан со сни­жением частоты индивидуального альфа пика – болезнь Альцгеймера, шизофре­ния, синдром хронического усталости, по­лушарный инсульт (Angealakis, 2004).

Интересным параметром для диагно­стики сдвигов функционального состо­яния является так называемый индекс утомления (ИУ), отражающий отноше­ния ритмов ЭЭГ. Ученые исследовали не­сколько таких индексов, показывающих отношения различных ритмов. Ченг с соавторами исследовали также эффек­тивность использования различных ал­горитмов, отражающих соотношение мощностей ритмов ЭЭГ, для определе­ния состояния утомления. В своем исследовании они использовали 3 индекса: тета/альфа, бета/альфа, (альфа+тета)/бета. В ходе эксперимента было пока­зано, что лучшие результаты по детек­ции утомления были получены с помо­щью индекса (альфа+тета)/бета (Cheng, 2011). Джап с соавторами также исследо­вали различные алгоритмы вычисления индекса утомления: ((тета+альфа)/бета, альфа/бета, (альфа+тета)/(альфа+бета), тета/бета) (Jap, 2009). Они, также как и Ченг, продемонстрировали, что алгоритм (тета+альфа)/бета имеет наибольшее уве­личение после длительной когнитивной нагрузки и является наиболее чувстви­тельным к изменениям функционально­го состояния по сравнению с остальными. Джап выявил, что данный индекс наибо­лее сильно увеличивается в центральных, теменных и височных областях при за­крытых глазах и в теменных и височ­ных областях при открытых глазах. Также Джап показал увеличение дельта и тета ак­тивности во фронтальных, центральных и теменных регионах (Jap, 2009).

Гипотеза исследования

Основной гипотезой исследования является предположение о том, что но­сители полиморфизма A2A2 гена DRD2 характеризуются меньшим развитием утомления в условиях длительной когнитивной нагрузки по сравнению с но­сителями A1 аллеля (A1A1 и A1A2 поли­морфизмы) по комплексу параметров (субъективных, поведенческих и элек­трофизиологических).

Методика исследования

Испытуемые и методики

В данном исследовании приняли учас­тие 51 испытуемый (мужчины-правши, средний возраст – 20±4 лет). Для данных испытуемых был проведен генетический анализ и определены варианты поли­морфизма Taq1A гена DRD2 (A1A1, A1A2 и A2A2). Схема эксперимента состояла из двух одинаковых блоков длительностью около 35 минут, разделенных серией раз­личных когнитивных заданий, направлен­ных в основном на использование вни­мания и рабочей памяти, длительностью около 2–2,5 часов. Каждый из двух блоков состоял из трех этапов: 1.Заполнение пси­хологического опросника САН (методика диагностики Самочувствия, Активности и Настроения); 2.Выполнение тестов на время реакции; 3.Запись ЭЭГ.

Методика САН заполнялась на компьютере непосредственно перед выполнением основных серий экспе­римента (заданий на время реакции и записи ЭЭГ). В исследовании исполь­зовались три вида заданий на время ре­акции: простая зрительно-моторная реакция (ПЗМР), реакция выбора (РВ) и максимальный теппинг (МТ). В серии с ПЗМР от испытуемого требовалось как можно быстрее нажимать на «кнопку 1» при появлении красного крестика в цен­тре экрана. В серии с РВ испытуемый должен был, при появлении красного крестика в центре экрана, нажимать так­же на «кнопку 1», а при предъявлении зеленого крестика - «кнопку 2». В серии с МТ испытуемый должен был нажимать «кнопку 1» с максимально возможной скоростью в течение одной минуты.

Стимульный материал

Для предъявления стимульного ма­териала использовалась программа E-prime (версия 1.2). Стимулы предъ­являлись на мониторе фирмы Dell с раз­решением экрана 1280×1024 пикселей. Все стимулы предъявлялись на черном фоне. Фиксационная точка находилась в центре экрана в виде белого крестика (Courier New, размер 18).

Для ПЗМР и РВ заданий длительность фиксационной точки и стимула находи­лась в промежутке между 500-1500 мс. В ПЗМР стимулом служил красный кре­стик в центре экрана (Courier New, размер 72). В РВ стимулом был красный кре­стик (Courier New, размер 72) и зеленый крестик (Courier New, размер 72), кото­рые предъявлялись в случайной последо­вательности. В обоих заданиях перед вы­полнением основной серии, испытуемые выполняли тренировочную серию из 10 стимулов. Основная серия же состояла из 70 стимулов. При анализе данных учиты­вались стимулы только из основной се­рии. В максимальном теппинге испыту­емые нажимали на кнопку в течение 60 секунд. Через 60 секунд выполнение зада­чи автоматически останавливалось.

Запись ЭЭГ

Запись ЭЭГ в данном исследовании про­водилась дважды: первый раз до когнитив­ной нагрузки, второй раз – после. Запись ЭЭГ проводилась с помощью 256-каналь­ного электроэнцефалографа фирмы EGI Electrical Geodesics с частотой оцифровки 500 Гц и референтом в вертексе. Фоновая ЭЭГ состояла из двух периодов записи – 1 минуты с закрытыми глазами и 1 мину­ты с открытыми глазами. После записи ЭЭГ проводился ремонтаж и фильтрация в полосе от 1 до 150 Гц и удалением 50 Гц наводки от сети.Каждая запись ЭЭГ была автоматически просканирована на нали­чие артефактов. Участки ЭЭГ с амплиту­дой более 200 мкВ в пределах окна в 640 мс отмечались как плохой канал, участки с амплитудой более 140 мкВ рассматрива­лись как двигательный артефакт, а более 55 мкВ – как зрительный артефакт (Net Station software).

Анализ данных

Для статистического анализа данных использовались пакет Statistica 8 (для Windows, V 8.0, StatSoft), а также пакет MatLab (версия R2007b). Статистические методы ANOVA и Т-тест для зависимых выборок были использованы для анализа влияния длительной когнитивной нагруз­ки на время реакции и субъективное со­стояние.

Для различных экспериментальных заданий (ПЗМР, РВ, МТ) и психологиче­ского опросника САН были вычислены средние значения и стандартные откло­нения. Для реакции выбора, также было вычислено количество ошибок.

Для анализа ЭЭГ использовались от­резки фоновой ЭЭГ длительностью 20 секунд с наименьшим содержанием ар­тефактов, зарегистрированные в состоя­ниях с закрытыми и открытыми глазами. На основе данных ЭЭГ были рассчитаны частота индивидуального альфа ритма (ИАР) и индекс утомления (ИУ). Индиви­дуальный альфа ритм рассчитывался как частота, на которой наблюдается макси­мальная мощность альфа ритма в диапа­зоне от 7 до 14 Гц. Подсчет индивидуаль­ного альфа ритма проводился с помощью программы MatLab. Индекс утомления был рассчитан как отношение суммы мощностей медленных ритмов (альфа и тета ритмов) к мощности быстрого ритма (бета): ИУ = (альфа + тета) / (бета)) (Jap et al, 2009, Cheng, 2011).

Генетический анализ. Методика генотипирования DRD2

Проводили полимеразную цепную реакцию (ПЦР). Полиморфизм опреде­ляли по длине продуктов после рестрик­ции.ДНК выделяли из 100 мкл цельной крови с помощью наборов «ДНК-сорб Б» производства ЦНИИЭ (Россия). Реак­цию проводили в объеме 25 мкл. Стан­дартная реакционная смесь включала: 67 мМ Трис-НCl (рН 8,4), 16 мМ суль­фата аммония, 2,5 mM MgCl2, 0,125 мг/ мл бычьего сывороточного альбумина, 8% глицерин, 0,001% ксиленцианол, 2,5 Ед Taq-ДНК-полимеразы (ЦНИИЭ, Россия), 0,2 мМ каждого из четырех дезок­синуклеозидтрифосфатов и по 8 пмоль праймеров. При постановке ПЦР обяза­тельно использовали технику «горячий старт», который обеспечивался разделе­нием нуклеотидов с праймерами и Taq-полимеразы прослойкой воска.

Для ПЦР-амплификации использова­ли следующие праймеры, фланкирую­щие полиморфный участок гена DRD2 (Farde L., Gustavsson J.P., Jonsson E., 2007).

5’-ССGTCGACCCTTCCTGAGTGTCAT CA-3’ прямой

5’-CCGTCGACGGCTGGCCAAGTTGTC TA-3’ обратный

Ожидаемая длина продукта амплифи­кации 310 п.о. для обоих аллелей. ПЦР проводили по следующей программе в ам­плификаторе Терцик (ДНК-технология):

94°С – 4 минут ¬– 1 цикл;

94°С – 30 сек., 58°С – 30 сек., 72°С – 30 сек; всего 35 циклов;

72°С – 5 мин – 1 цикл;

Хранение: +10°С.

Затем к 7.5 мкл каждого образца до­бавляли определенное количество ре­стриктазы Taq I, эквивалентное 5 едини­цам активности фермента и проводили рестрикцию амплифицированных про­дуктов в течение 22 часов при 65°С в су­ховоздушном термостате.

Мутантный аллель А1 не расщепляет­ся.А2 аллель (дикий тип) расщепляется на продукты длинной 130 и 180 п.о.

Детекцию продуктов проводили с по­мощью электрофореза в 3% агарозном геле. Гель готовили на ТАЕ-буфере (0,1 М трис, 0,1 М уксусная кислота, 2 мМ ЭДТА, рН 8,3) с добавлением бромистого эти­дия до конечной концентрации 0,00001 %. Электрофорез проходил с охлажде­нием при напряжении 100 V в течение 1 часа. Результат детектировали на тран­силлюминаторе ТСР 15М (Vilber lourmat) с помощью системы видеодетекции «DNA Analyzer».

Результаты

По данным генетического анализа в данной выборке по гену DRD2 были вы­делены следующие группы: наличие по­лиморфизма A1A1 – 1 человек, A1A2 – 14 человек, A2A2 – 36 человек. Носители полиморфизмов A1A1 и A1A2 были объ­единены в одну группу «А1+» на основе литературных данных, которые показы­вают, что наличие аллеля А1 приводит к уменьшению плотности рецепторов до­фамина в синаптической щели на 30-40 %, по сравнению с плотностью рецепто­ров у носителей генотипа А2А2, которые были объединены в группу «А1-».

Субъективные показатели

Методика САН

Статистический анализ показал, что в состоянии утомления, вызванном дли­тельной когнитивной нагрузкой, проис­ходит значимое снижение субъективных ощущений по шкалам Самочувствие, Активность и общему баллу (таблица 1). При этом значимых различий между группами «A1-» и «A1+» не наблюдается. Полученные результаты говорят о том, что на субъективном уровне все испыту­емые испытывали некоторое утомление после прохождения эксперимента, но значимых различий у носителей разных полиморфизмов не наблюдалось.

Таблица 1. Методика САН (ген DRD2)

 

Самочувствие

Активность

Настроение

Общий балл

A1+

5.4/4.4**

5.1/4**

5.4/5.2

5.3/4.5**

A1-

5.5/4.7**

5/4.3**

5.4/5.2

5.3/4.8**

До утомления/после утомления, шкала: 1-7 баллов

Поведенческие показатели

Простая зрительно-моторная реакция (ПЗМР)

Статистический анализ ANOVA по­казал, что в целом наблюдается значи­тельное снижение скорости в состоя­нии утомления, вызванном длительной когнитивной нагрузкой (F(1,47) =6,479; p<0,01). Также результаты исследова­ния продемонстрировали, что две груп­пы носителей полиморфизмов «A1+» и «A1-» значимо различаются между со­бой: F(1,47) =6,960; p <0,01. Группа «A1-» характеризуется значимо более высо­кой скоростью реакции, по сравнению с группой «A1+».

Таблица 2. Простая зрительно-моторная реакция

DRD2

До утомления, мс (ст.откл.)

После утомления, мс (ст.откл.)

A1+

221.9 (16.4)

227.6 (14.4)

A1-

232.3 (21.1)

243.6 (30)*

*значимые изменения (p≤0.05)

Реакция выбора

Статистический анализ ANOVA по­казал, что в целом наблюдается умень­шение времени реакции выбора после утомления (F(1,47) =12,869; p<0,0008). Также было выявлено, что полиморфиз­мы «A1+» и «A1-» значимо различаются между собой (F(1,47) =5,643; p<0,02). Ана­лиз данных ANOVA продемонстрировал, что количество ошибок значимо возра­стает в целом (F(1,47) =9,6754; p<0,004), но между собой полиморфизмы не раз­личаются по количеству ошибок.

Таблица 3. Реакция выбора

 

Время реакции, мс

ОШИБКИ

DRD2

До утомления

После утомления

До утомления

A1+

400.2 (43.9)

377.9 (44.9)**

6.1

A1-

430.1 (60.1)

413.6 (59.5)*

6.1

*значимые изменения (p≤0.05);

** значимые изменения (p≤0.01)

Максимальный теппинг

Статистический анализ ANOVA не вы­явил значимых различий между поли­морфизмами в максимальном теппинге в гене DRD2.При этом у группы «A1+» наблюдается значимое снижение ско­рости (F(1,28) =6,30; p<0,02), тогда как у группы «A1-» – нет.

Таблица 4. Максимальный теппинг

DRD2

До утомления, мс

После утомления, мс

A1+

170(16)

175(12)

A1-

175(18)

172(19)

ЭЭГ результаты

Частота индивидуального альфа ритма (ИАР)

Статистический тест ANOVA не выявил значимых изменений ИАР после утом­ления у групп «A1+» и «A1-». При этом у носителей A2A2 полиморфизма ИАР не уменьшается, а у носителей А1 алле­ля – наблюдается значимое уменьшение ИАР в обоих полушариях (F(1,11) =7,678; p<0,02).

В таблице 5 представлены показате­ли средних значений ИАР со стандартны­ми отклонениями для обеих групп «A1+» и «A1-» до и после утомления. Группа «А1-» ха­рактеризуется в целом большим значением ИАР, по сравнению с носителями «A1+». Результаты Т-теста показали, что после ког­нитивной нагрузки значимых изменений по показателю ИАР у группы «A1-» не наблюдается, а вот группа «A1+» характеризу­ется значимым снижением частоты ИАР во фронтальной, теменной, затылочной об­ластях, а также в среднем по всему скальпу.

Таблица 5. ИАР до и после утомления у гена DRD2

Области мозга

ИАР, Гц/ст.откл.

«A1+» группа

«A1-» группа

До утомления

После утомления

До утомления

После утомления

Лобная левая

10,10 (0,88)

9,53 (1,02)*

9,63 (0,96)

9,69 (1,01)

Лобная правая

10,06 (0,87)

9,43 (1,06)*

9,77 (0,96)

9,72 (1,08)

Центральная левая

9,84 (0,70)

9,45 (1,10)

9,75 (0,98)

9,77 (1,10)

Центральная правая

9,77 (0,79)

9,30 (1,07)*

9,73 (1,03)

9,68 (1,03)

Теменная левая

9,89 (0,85)

9,68 (0,97)

9,96 (0,99)

10,04 (1,04)

Теменная правая

10,23 (0,43)

9,73 (0,74)

10,10 (1,02)

10,01 (0,99)

Височная левая

9,96 (0,92)

9,69 (1,14)*

9,81 (0,95)

9,73 (0,96)

Височная правая

10,18 (0,51)

9,60 (0,91)*

9,89 (0,93)

9,80 (0,96)

Затылочная левая

10,14 (0,82)

9,57 (0,77)*

9,97 (1,05)

9,90 (0,97)

Затылочная правая

10,35 (0,53)

9,69 (0,70)*

10,01 (0,98)

9,90 (0,90)

*значимые изменения (p≤0.05);

** значимые изменения (p≤0.01)

Индекс утомления

В таблице 6 показаны средние значе­ния параметра индекс утомления (ИУ) со стандартными отклонениями для обеих групп «A1+» и «A1-» до и после когнитивной нагрузки. Носители А1-аллеля характеризуются в целом большим значением индекса утомления, по срав­нению с носителями А2-аллеля в фо­новом состоянии. Результаты Т-теста показали, что после утомления более сильное увеличение индекса утомления наблюдается у группы «A1-». Статистиче­ский анализ ANOVA показал, что группы «A1+» и «A1-» значимо не различаются.

Таблица 6. Индекс утомления до и после утомления у гена DRD2

Области мозга

ИАР, Гц/ст.откл.

«A1+» группа

«A1–» группа

До утомления

После утомления

До утомления

После утомления

Лобная левая

3,72 (2,32)

4,18 (2,82)

4,65 (3,00)

5,18 (3,15)

Лобная правая

6,31 (2,84)

7,12 (3,32)*

7,27 (2,65)

7,77 (2,46)

Центральная левая

2,66 (1,40)

3,27 (1,72)

3,59 (2,81)

4,36 (2,45)

Центральная правая

2,78 (1,34)

4,16 (2,58)**

3,62 (2,95)

4,97 (2,57)**

Теменная левая

3,37 (2,91)

4,42 (3,41)

3,66 (3,09)

5,31 (3,04)**

Теменная правая

4,58 (4,17)

5,78 (5,02)

5,00 (3,90)

6,56 (3,89)**

Височная левая

2,49 (1,38)

3,96 (2,74)*

3,26 (2,46)

4,10 (2,33)*

Височная правая

2,97 (3,25)

3,92 (3,85)*

3,24 (2,15)

4,26 (2,70)*

Затылочная левая

3,14 (2,40)

4,44 (3,88)*

3,97 (3,08)

4,62 (2,57)*

Затылочная правая

3,11 (2,63)

4,38 (3,69)*

3,56 (2,58)

4,40 (2,27)*

* значимые изменения (p≤0,05);

** значимые изменения (p≤0,01)

Обсуждение результатов

Субъективные показатели

В субъективном состоянии после дли­тельной когнитивной нагрузки отмеча­ется снижение показателей по шкалам самочувствие и активность как у поли­морфизма A2A2, так и у полиморфиз­мов А1А1+А1А2. Многие исследователи отмечают, что после длительной когни­тивной деятельности испытуемые себя чувствуют намного хуже, чем до нее (Wijesuriya et al, 2007; Lorist et al., 2005; Trejo et al., 2005; Cheng, 2011). Так, Трейо обнаружил, что после трех часов реше­ния арифметических задач субъектив­ная оценка по шкалам энергичность и спокойствие значимо снижаются, а значение по шкале усталость – значимо возрастает (Trejo et al, 2005).

Таким образом, в целом можно за­ключить, что на субъективном уровне все полиморфизмы гена DRD2 испыты­вают утомление, и значимых различий в субъективных оценках между полиморфизмами выявлено не было.

Поведенческие показатели

В поведенческих реакциях было об­наружено значимое снижение скоро­сти в простой зрительно-моторной ре­акции, что может свидетельствовать о том, что испытуемые испытывали состо­яния утомления. Также наблюдалось уве­личение скорости реакции выбора с од­новременным увеличением количества ошибок. Это может также говорить о том, что испытуемые испытывали утомление и, пытаясь сохранить высокую скорость выполнения задания, они жертвовали точностью его выполнения. Различные исследования показали уменьшение ско­рости в ПЗМР с развитием умственного утомления (Lorist et al, 2005; Boksem et al, 2006; Trejo et al,2005). Некоторые ав­торы обнаружили, что при выполнении реакции выбора после длительной когнитивной нагрузки, наблюдается не уве­личение времени реакции, а ее сниже­ние (т.е. увеличение скорости), и вместе с этим возрастает количество ошибок. Этот эффект был назван «Компромиссом скорости и точности» (Wickelgren, 1977, Wood, 1976; Sternberg, 2004). Разные исследователи предлагали различные тео­рии объяснения этого феномена. Одной из основных является теория о том, что с увеличением времени выполнения за­дания, то есть с возрастанием утомления происходит смещение отношения меж­ду контролируемыми ответами на стимул и случайными ответами на него, который по латенции гораздо короче контролируемого. И по мере увеличения утомле­ния это соотношение смещается в сто­рону случайных ответов. Таким образом, при увеличении утомления происходит уменьшение скорости ответа и возраста­ние количества ошибок (Ollman, 1966; Yellott, 1971). Еще одной теорией, объя­сняющей уменьшение времени реакции выбора после длительной когнитивной нагрузки является гипотеза о том, что во время выполнения задания у испытуемо­го постоянно копится информация о уже выполненных заданиях, что позволяет ему быстрее отвечать на стимул, но из-за влияния утомления на когнитивную сфе­ру происходит увеличение количества ошибок (Knight, 1974).

Интересным фактом является то, что группа носителей полиморфизма А2А2 («А1»), который, как мы предполагали, бу­дет показывать меньшее развитие утомле­ния, характеризуется в ПЗМР и РВ значи­мо более медленным временем реакции и до и после длительной когнитивной на­грузки, по сравнению с носителями по­лиморфизмов А1А1 и А1А2 («А1+»). Сто­ит отметить, что динамика увеличения ошибок у всех полиморфизмов одинакова и по количеству ошибок генотипы не различаются ни до, ни после утомления. При этом направленность динамики измене­ния времени реакции после утомления у всех полиморфизмов примерно одина­кова. Это означает, что полиморфизмы различаются в ПЗМР и РВ не динамикой развития утомления, а физиологической предрасположенностью к сенсорной об­работке информации.

В максимальном теппинге носители А2А2 («А1-») полиморфизма характери­зуются значимым увеличением скоро­сти после когнитивной нагрузки, тогда как у «А1+» группы наблюдается замедление скорости, но незначимое.

Максимальный теппинг отражает мо­торный компонент – физиологическую способность организма к мышечному со­кращению, которая зависит, в том числе и от активности мотонейронов. В ПЗМР время реакции включает в себя помимо моторного компонента (непосредствен­ной реакции), также и информационный компонент (восприятие стимула). В РВ время реакции включает в себя, помимо вышеперечисленных компонентов, еще и когнитивный компонент (процесс оцен­ки и принятия решения, какую кнопку на­жать). Согласно полученным эксперимен­тальным данным, в ПЗМР время реакции у двух групп («А1+» и «А1-») значимо различается. В РВ – также наблюдается значи­мое различие двух групп полиморфизмов. В максимальном теппинге группы харак­теризуются разнонаправленной динами­кой изменения скорости реакции до и по­сле утомления, но незначимо.

Полученные результаты позволяют предположить положительную роль до­фамина в обеспечении протекания ин­формационной обработки. Об этом сви­детельствует тот факт, что носители полиморфизмов А1А1 и А1А2, которые характеризуются меньшей плотностью рецепторов к дофамину, отличаются зна­чимо более высокой скоростью реагиро­вания в ПЗМР и РВ, по сравнению с но­сителями А2А2 полиморфизма. При этом более значимые результаты получены в реакции выбора, которая требует гораздо большей информационной обработки. Данные максимального теппинга могут свидетельствовать о том, что у А2А2 но­сителей развитие утомления происходит медленнее, чем у А1А1+А1А2, так как они характеризуются ускорением скорости после длительной когнитивной нагрузки, тогда как носители А1-аллеля – характеризуются замедлением скорости. Родригес показал, что изменения в максимальном теппинге имеют центральное происхо­ждение (Rodrigues, 2009). Таким образом, увеличение скорости в максимальном теп­пинге связано с большей активацией мото­нейронов в головном мозге.

ЭЭГ показатели

Индивидуальный альфа ритм

В ходе анализа индивидуальной ча­стоты альфа-ритма, были также получе­ны интересные результаты. Показано, что носители А1-аллеля характеризуются большим снижением ИАР после утомле­ния, преимущественно в правом полуша­рии. Тогда как у группы «А1-» такого зна­чимого снижения обнаружено не было. У группы «А1-» снижение ИАР в среднем происходит с 9,86 Гц до 9,82 Гц. А у груп­пы «А1+» – с 10,05 Гц до 9,57 Гц.

Таким образом, мы видим, что группа «А1+» характеризуется не только мень­шим снижением ИАР, но и более высокой его частотой как до, так и после утомле­ния. В ряде исследований было показано, что пик альфа ритма положительно кор­релирует с такими процессами, как вни­мание, память, скорость сенсорной об­работки (Angelakis, 2004; Klimesh, 1999). Климеш показал, что испытуемые с вы­сокими мнестическими способностями и высокой скоростью обработки информации характеризуются частотой альфа пика в среднем на 1 Гц большей по срав­нению с контрольной группой (Klimesh, 1996, 1997). Испытуемые со сниженными мнестическими способностями характе­ризуются снижением пика альфа ритма во время выполнения заданий на память, а испытуемые с высокими мнестическими способностями характеризуются стабиль­ностью пика альфа ритма в различных условиях (Klimesh, 93). При длительном выполнении когнитивных заданий многие авторы отмечают снижение индивидуаль­ной частоты альфа ритма (Angelakis, 2004; Klimesh, 1999; Jap, 2009; Lal et al, 2007).

В целом, полученные результаты соот­ветствуют данным предыдущих исследо­ваний, согласно которым считается, что максимальный альфа ритм регистрирует­ся в затылочных и теменых областях при закрытых глазах (Кропотов, 2010; Голубе­ва, 2005). В ряде работ было также пока­зано увеличение мощности альфа ритма при умственном утомлении (Boksem et al, 2006; Trejo et all, 2005; Jap, 2009). Хотя не­которые исследователи отмечают умень­шение мощности альфа ритма после дли­тельной когнитивной нагрузки (Lal et al, 2007; Cheng, 2011). Климеш считает, что снижение мощности альфа ритма после когнитивной нагрузки, например, после арифметических задач происходит из-за того, что такая деятельность требует уча­стия рабочей памяти, что в свою очередь приводит к подавлению альфа ритма на ЭЭГ (Klimesh, 1997).

Индекс утомления

Индекс утомления отражает отноше­ние медленных мозговых ритмов к бы­стрым ((альфа+тета)/бета). Буди Томас Джап в своем исследовании показал, что алгоритм (альфа+тета)/бета имеет более сильное увеличение по сравне­нию с другими индексами (альфа/бета, (альфа+тета)/(альфа+бета), тета/бета) и является наиболее чувствительным к изменениям функционального состо­яния (Jap, 2009). Ченг с соавторами так­же продемонстрировали, что индекс (альфа+тета)/бета показывает более значимое изменение после длительной когнитивной нагрузки, по сравнению с другими индексами (тета/альфа, бета/ альфа) (Cheng, 2011).

В нашем исследовании по показате­лям индекса утомления значимых раз­личий между группами «А1+» и «А1-» полиморфизмами обнаружено не было. У группы «А1+» увеличение индекса утомления наблюдается в среднем с 3,51 до 4,56. У группы «А1-» увеличение ИУ наблюдается в среднем с 4,18 до 5,15.

Заключение

В настоящем исследовании мы в це­лом подтвердили нашу гипотезу о том, что носители полиморфизма A2A2 гена DRD2 характеризуются меньшим разви­тием утомления в условиях длительной когнитивной нагрузки по сравнению с носителями A1 аллеля (A1A1 и A1A2 полиморфизмы) по комплексу параметров (субъективных, поведенческих и электрофизиологических). Группа «А1+» – носители A1A1 и A1A2 полиморфизмов, ассоциированных с меньшей плотно­стью рецепторов дофамина и, соответ­ственно, с меньшим его уровнем, харак­теризуется снижением индивидуальной частоты альфа-ритма в обоих полушариях после когнитивной нагрузки, но при этом увеличением скорости простой зрительно-моторной реакции и реак­ции выбора. Группа «А-» характеризует­ся отсутствием изменений индивидуального альфа-ритма и более быстрым и стабильным значением максимального теппинга. Полученные результаты сви­детельствуют о положительной роли до­фамина в развитии утомления.

Исследование выполнено при поддержкегранта РГНФ № 14-06-00698a

Литература:

Голубева Э.А. Способности. Личность. Индивидуальность. – Дубна: «Феникс+», 2005. – 512 с.

Зинченко Ю.П., Тоневицкий А.Г., Веракса А.Н., Исайчев С.А., Леонов С.В., Меньшикова Г.Я., Стрелков Ю.К., Сысоева О.В., Черноризов А.М. Психология спорта. М.: Изд-во Моск. ун-та, 2011 – надо – Зинченко Ю.П., Тоневицкий А.Г., Веракса А.Н. и др. Психология спорта. – Москва: Изд-во Моск. ун-та, 2011.

Кропотов Ю.Д. Количественная ЭЭГ, когнитивные вызванные потенциалы мозга человека и нейротерапия. – Санкт-Петербург, 2010. – 506 с.

Angelakis, E., Lubar, J.F., Stathopoulou, S., & Kounios, J. (2004) Peak alpha frequency: an electroencephalographic measure of cognitive preparedness. Clin Neurophysiol. Apr; 115(4):887-97. doi: 10.1016/j.clinph.2003.11.034

Barnes, J.M., Dean, A.J., Nandam, L.S., & O’Connell, R.G. (2011) The Molecular Genetics of Executive Function: Role of Monoamine System Genes. Biological Psychiatry. Vol. 69, Issue 12, 127-143. doi: 10.1016/j.biopsych.2010.12.040

Binnie, C.D., Cooper, R., Mauguiere, F., Prior, P., & Tedman, B. (2003) Electroencephalography, Paediatric Neurophysiology, Special Techniques and Applications. Clinical Neurophysiology. Vol. 2.

Blomstrand, E. (2001) Amino acids and central fatigue. Amino Acids. Vol. 20, 25-34. doi: 10.1007/s007260170063

Blum, K., Braverman, E.R., Wu, S., Cull, J.G., Chen, T.J., & Gill, J. (1997) Association of polymorphisms of dopamine D2 receptor (DRD2), and dopamine transporter (DAT1) genes with schizoid/avoidant behaviors (SAB). Molecular Psychiatry. Vol. 2, 239-246. doi: 10.1038/sj.mp.4000261

Boksem, M.A., Meijman, T.F., & Lorist, M.M. (2006) Mental fatigue, motivation and action monitoring. Biol Psychol 72: 123–132. doi: 10.1016/j. biopsycho.2005.08.007

Bolton, J.L., Marioni, R.E., Deary, I.J., Harris, S.E., Stewart, M.C., Murray, G.D., Fowkes, F.G.R., & Price, J.F. (2010) Association between polymorphisms of the dopamine receptor D2 and catechol-o-methyl transferase genes and cognitive function. Behavior Genetics. Vol. 40, 630-638; doi: 10.1007/s10519-010- 9372-y

Cheng, Shyh-Yueh & Hsu, Hong-Te (2011) Mental Fatigue Measurement Using EEG, Risk Management Trends, Giancarlo Nota (Ed.), ISBN: 978-953- 307-314-9.

Davis, J.M., Alderson, N.L., & Welsh, R.S. (2000) Serotonin and central nervous system fatigue: nutritional considerations. The American Journal of Clinical Nutrition. Vol. 72, 573-8.

Davis, J.M., & Bailey, S.P. (1997) Possible mechanisms of central nervous system fatigue during exercise. Medicine and Science in Sport and Exercise. Vol. 29, 1, 45-57; doi: 10.1097/00005768-199701000-00008

Epstein, H.T. (1980) EEG developmental stages. Developmental Psychobiology. Vol. 13, 629–631. doi: 10.1002/dev.420130608

Farde, L., Gustavsson, J.P., & Jonsson, E. (1997) D2 dopamine receptors and personality traits. Nature; 385-590. doi: 10.1038/385590a0

Fernandez, T., Harmony, T., Rodriguez, M., Reyes, A., Marosi, E., & Bernal, J. (1993) Test–retest reliability of EEG spectral parameters during cognitive tasks: I. Absolute and relative power. International Journal of Neuroscience. Vol. 68, 255– 261. doi: 10.3109/00207459308994280

Fernstrom, J.D., & Fernstrom, M.H. (2006) Exercise, serum free tryptophan, and central fatigue. Journal of Nutrition. Vol. 136, 2, 553-559;

Foley, T.E., & Fleshner, M. (2008) Neuroplasticity of dopamine circuits after exercise: implications for central fatigue. NeuroMolecular Medicine. Vol. 10, 67-80; doi: 10.1007/s12017-008-8032-3

Goljahani, A., D’Avanzo, C., Schiff, S., Amodio, P., Bisiacchi, P., & Sparacino, G. (2012) A novel method for the determination of the EEG individual alpha frequency. Neuroimage. Vol. 60, 774-786. doi: 10.1016/j.neuroimage.2011.12.001

Gosso, M.F., de Geus, E.J.C., Polderman, T.J.C., Boomsma, D.I., Heutink, P., & Posthuma, D. (2008) Catechol O-methyl transferase and dopamine D2 receptor gene polymorphisms: evidence of positive heterosis and gene-gene interaction on working memory functioning. The American Journal of Human Genetics. Vol. 16, 1075-1082. doi: 10.1038/ejhg.2008.57

Jap, Budi Thomas, Lal, Sara, Fischer, Peter, & Bekiaris, Evangelos (2009) Using EEG spectral components to assess algorithms for detecting fatigue. Expert Systems with Applications. Volume 36, Issue 2, Part 1, 2352-2359.

Joyce, N.J., Sapp, D.W., & Marshall, J.F. (1986) Human striatal dopamine receptors are organized in compartments. PNAS. Vol. 83, 8002-8006. doi: 10.1073/pnas.83.20.8002

Kaasinen, V., Aalto, S., Nagren, K., & Rinne, J.O. (2004) Insular dopamine D2 receptors and novelty seeking personality in Parkinson’s disease. Movement Disorders. Vol. 19, 11, 1348-1351. doi: 10.1002/mds.20191

Khaustova, S.A., Shkurnikov, M.U., & Tonevitsky, A.G. (2010) Short highly intense exercise causes changes in salivary concentrations of hydrocortisone and secretory IgA. Bull. Exp. Biol. Med.. Vol. 149, 5, 635–9. doi: 10.1007/s10517-010-1012-2

Kidd, K.K., Morar, B., Castiglione, C.M., Zhao, H., Pakstis, A.J., & Speed, W.C. et al. (1998) A global survey of haplotype frequencies and linkage disequilibrium at the DRD2 locus. Human Genetics. Vol. 103, 2, 211-227. doi: 10.1007/s004390050809

Klimesch, W., Schimke, H., & Pfurtscheller, G. (1993) Alpha frequency, cognitive load and memory performance. Brain Topography, 5, 241-251. doi: 10.1007/BF01128991

Klimesch, W. (1996) Memory processes, brain oscillations and EEG synchronization. Int J Psychophysiol. doi: 10.1016/S0167-8760(96)00057-8

Klimesch, W. (1997) EEG-alpha rhythms and memory processes. International Journal of Psychophysiology. 26, 319-340. doi: 10.1016/S0167- 8760(97)00773-3

Klimesch, Wolfgang (1999) EEG alpha and theta oscillations reflect cognitive and memory performance: a review and analysis. Brain Research Reviews. 29,169–195. doi: 10.1016/S0165-0173(98)00056-3

Knight, J.L. (1974) Speed-accuracy tradeoff in double stimulation: Effects on the first response. Memory & Cognition, Vol. 2, 3, 522-532. doi: 10.3758/ BF03196915

Lal, Sara & Bekiaris, Evangelos (2007) The Reliability of Sensing Fatigue from Neurophysiology. AusWireless 2006: International Conference on Wireless Broadband and Ultra Wideband Communications Proceedings. EEG-based Estimation of Cognitive Fatigue. URL.: http://hdl.handle.net/10453/19642 ). - (reference date: 09.08.2016)

Lorist, Monicque, Boksem, Maarten, Ridderinkhof, Richard (2005) Impaired cognitive control and reduced cingulate activity during mental fatigue. Cognitive Brain Research. 24, 199– 205; doi: 10.1016/j.cogbrainres.2005.01.018

Malyuchenko, N., Schegolkova, J., Kulikova, M., Timofeeva, M., Shlepzova, V., Sysoeva, O., Ivanitsky, A., & Tonevitsky, A. (2010) Effects of Genetic Variations in the Dopaminergic System on Fatigue in Humans: Gender Aspects. Bulletin of Experimental Biology and Medicine. Vol. 149, 226-232; doi: 10.1007/s10517-010-0913-4

Meeusen, R., & Watson, P. (2007) Amino acids and the brain: do they play a role in “central fatigue”? International journal of sport nutrition and exercise. Suppl. 17, 37-46;

Newsholme, E.A., & Blomstrand, E. (1995) Tryptophan 5-hydroxytryptamine and a possible explanation for central fatigue. Advances in Experimental Medicine and Biology. Vol. 384, 315-320; doi: 10.1007/978-1-4899-1016-5_25

Newsholme, E.A., Blomstrand, E., & Ekblom, B. (1992) Physical and mental fatigue: metabolic mechanisms and importance of plasma amino acids. British Medical Bulletin. Vol. 48, 477–95;

Nieoullon, André (2002) Dopamine and the regulation of cognition and attention. Progress in Neurobiology. Vol. 67, Issue 1, 53–83; doi: 10.1016/S0301- 0082(02)00011-4

Ollman, R. (1966) Fast guess in choice reaction time. Psychonomic Science. 6, 155-156; doi: 10.3758/BF03328004

Petersen, I., & Eeg-Olofsson, O. (1971) The development of the electroencephalogram in normal children from the age of 1 through 15 years – Non-paroxysmal activity. Neuropädiatrie. Vol. 2, 375–404; doi: 10.1055/s-0028-1091786

Polikanova, I.S., Sysoeva, O.V., & Tonevitsky, A.G. (2012) Association between serotonin transporter (5HTT) and mental fatigue development. Psikhologicheskie Issledovaniya, Vol. 5, 24, 7. http://psystudy.ru  (in Russian, abstr. in English) - (reference date: 09.08.2016).

Reuter, M., Roth, S., Holve, K., & Hennig, J. (2006) Identification of first candidate genes for creativity: A pilot study. Brain Research. Vol. 1069, 190-197. doi: 10.1016/j.brainres.2005.11.046

Ritchie, T., & Noble, E.P. (2003) Association of seven polymorphisms of the D2 dopamine receptor gene with brain receptor-binding characteristics. Neurochemical Research. Vol. 28, 73-82; doi: 10.1023/A:1021648128758

Rodrigues, Julian, Mastaglia, Frank, & Thickbroom, Gary (2009) Rapid slowing of maximal finger movement rate: fatigue of central motor control? Exp Brain Res. doi: 10.1007/s00221-009-1886-2

Salamone, J.D. (2010a) Involvement of nucleus accumbens dopamine in behavioral activation and effort-related functions. In: Eds. Iversen L.L., Iversen S.D., Dunnett S.B., & Bjorkland A. Dopamine handbook. Oxford, UK, Oxford University Press.

Salamone. J.D. (2010b) Motor function and motivation. In: Eds. Koob, G., Le Moal, M., Thompson, R.F. Encyclopedia of behavioral neuroscience. Vol. 3. Oxford, Academic Press, 267–276. doi: 10.1016/B978-0-08-045396-5.00247-5

Salamone, J.D., Aberman, J.E., Sokolowski, J.D., & Cousins, M.S. (1999) Nucleus accumbens dopamine and rate of responding: Neurochemical and behavioral studies. Psychobiology. Vol. 27, 236-247.

Shkurnikov, M.U. et al. (2008) Free testosterone as marker of adaptation to medium-intensive exercise. Bull. Exp. Biol. Med. Vol. 146, 3, 354–7. doi: 10.1007/s10517-008-0292-2

Sternberg, Saul (2004) Reaction-Time Experimentation. Psychology 600-301/ Proseminar in Psychological Methods. Spring Semester.

Thompson, J. et al. (1997) D2 dopamine receptor gene (DRD2) TaqI A polymorphism: Reduced D2 receptor binding in the human striatum associated with the A1 allele. Pharmacogenetics. Vol. 7, 6, 479-484. doi: 10.1097/00008571-199712000-00006

Trejo, L., Knuth, K., Prado, R., Rosipal, R., Kubitz, K. Kochavi, R., Matthews, B., & Zhang, Y. (2007). EEG-Based Estimation of Mental Fatigue: Convergent Evidence for a Three-State Model. HCI International 2007 and Augmented Cognition International Conference, Beijing, 22-27 July 2007. In D.D. Schmorrow, & L.M. Reeves (Eds.), Augmented Cognition, HCII 2007, LNAI 4565, 201-211. New York: Springer LNCS.

Tsai, S.J., Yu, Y.W., Lin, C.H., Chen, T.J., Chen, S.P., & Hong, C.J. (2002) Dopamine D2 receptor and N-methyl-D-aspartate receptor 2B subunit genetic variants and intelligence. Neuropsychobiology. Vol. 45, 128-1. doi: 10.1159/000054951

Trejo, L., Knuth, K., Prado, R., Rosipal, R., Kubitz, K. Kochavi, R., Matthews, B., & Zhang, Y. (2007). EEG-Based Estimation of Mental Fatigue: Convergent Evidence for a Three-State Model. HCI International 2007 and Augmented Cognition International Conference, Beijing, 22-27 July 2007. In D.D. Schmorrow, & L.M. Reeves (Eds.), Augmented Cognition, HCII 2007, LNAI 4565, 201-211. New York: Springer LNCS. doi: 10.1007/978-3-540-73216-7_23

Wickelgren, Wayne (1977) Speed-accuracy tradeoff and information processing dynamics. Acta Psychologica. Volume 41, Issue 1, February 1977, 67–85; doi: 10.1016/0001-6918(77)90012-9

Wijesuriya, Nirupama, Tran, Yvonne, Craig, Ashley (2007) The psychophysiological determinants of fatigue. Int J Psychophysiol. doi: 10.1016/j. ijpsycho.2006.08.005

Wood, C.C., & Jennings, J.R. (1976) Speed-accuracy tradeoff functions in choice reaction time: Experimental designs and computational procedures. Perception & Psychophysics. Vol. 19, 92-102; doi: 10.3758/BF03199392

Yellott, John (1971) Correction for fast guessing and the speed-accuracy tradeoff in choice reaction time, Journal of Mathematical Psychology. 8, 159-199. doi: 10.1016/0022-2496(71)90011-3

En

Polikanova I.S., Korshunov A.V., Leonov S.V., Veraksa A.N. (2016). Association to dopamine receptor D2 (DRD2) with developing fatigue as a result of long-term cognitive load. National Psychological Journal. 3, 115-126.

Ru

Поликанова И.С., Коршунов А.В., Леонов С.В., Веракса А.Н. Ассоциация рецептора к дофамину второго типа (DRD2) с развитием утомления в результате длительной когнитивной нагрузки. // Национальный психологический журнал. – 2016. – № 3(23). – С. 115-126.

Keywords / Ключевые слова

fatigue / утомление ; cognitive load / когнитивная нагрузка ; EEG / ЭЭГ ; EEG data / данные ЭЭГ ; the individual alpha rhythm / индивидуальный альфа ритм ; the fatigue index / индекс утомления ; spectral characteristics / спектральные характеристики ; dopamine / дофамин

Abstract

This research studies the effect of long-term cognitive load on developimg fatigue on a range of subjective, behavioural (reaction time) and electrophysiological (individual alpha rhythm), fatigue index parameters in carriers of various polymorphisms of DRD2 genes. Mental fatigue was modeled as a result of continuous cognitive tasks aimed at using attention and working memory for 2.5 hours.

The sample included 51 subjects (male right-handers, the average age - 20 ± 4 years) whose genetic analysis was conducted and polymorphism options of DRD2 gene Taq1A (A1A1, A1A2 and A2A2) were identified.

The research results show that such load significantly affects almost the entire complex of indicators. Significant differences were found between the polymorphisms carriers A1A1 and A1A2 and A2A2 of DRD2 gene polymorphism in the reaction of choice, and also in fatigue index, which reflects the ratio of slow brain rhythms to fast. The results show the positive role of dopamine in developing fatigue.

Group of A2A2 («A1») polymorphism carriers was assumed to show lower fatigue, characterized in SVMR and PB significantly slower reaction time, and before and after long-term cognitive load, compared with carriers of polymorphisms A1A1 and A1A2 (« A1 + «).

Notably, the dynamics of error increase within all polymorphisms is the same, and genotype number of errors does not vary before or after fatigue. The dynamics of reaction time after the exhaustion of all SNPs is approximately the same. This means that polymorphisms are different not only in dynamics of fatigue but physical predisposition to sensory information processing.

Аннотация

Данное исследование посвящено изучению влияния длительной когнитивной нагрузки на развитие утомления по комплексу субъективных (тест САН), поведенческих (время реакции) и электрофизиологических (индивидуальный альфа-ритм (ИАР), индекс утомления (ИУ)) параметров у носителей различных полиморфизмов гена DRD2. Умственное утомление моделировалось с помощью непрерывного решения испытуемым когнитивных заданий, направленных на использование внимания и рабочей памяти, в течение 2,5 часов.

В данном исследовании приняли участие 51 испытуемый (мужчины-правши, средний возраст – 20±4 лет). Для данных испытуемых был проведен генетический анализ и определены варианты полиморфизма Taq1A гена DRD2 (A1A1, A1A2 и A2A2).

Как показывают результаты исследования, такая нагрузка значимо отражается практически на всем комплексе показателей. Обнаружены значимые различия между носителями полиморфизмов A1A1 и A1A2 и полиморфизма A2A2 гена DRD2 в реакции выбора, а также по индексу утомления, отражающему отношение медленных ритмов мозга к быстрым. Полученные результаты свидетельствуют о положительной роли дофамина в развитии утомления.

Группа носителей полиморфизма А2А2 («А1 »), который, как мы предполагали, будет показывать меньшее развитие утомления, характеризуется в ПЗМР и РВ значимо более медленным временем реакции и до и после длительной когнитивной нагрузки, по сравнению с носителями полиморфизмов А1А1 и А1А2 («А1+»). Стоит отметить, что динамика увеличения ошибок у всех полиморфизмов одинакова и по количеству ошибок генотипы не различаются ни до, ни после утомления. При этом направленность динамики изменения времени реакции после утомления у всех полиморфизмов примерно одинакова. Это означает, что полиморфизмы различаются в ПЗМР и РВ не динамикой развития утомления, а физиологической предрасположенностью к сенсорной обработке информации.

Author(s) / Автор(ы)

Polikanova, Irina S. / Поликанова И.С.  ; Korshunov, A. V. / Коршунов А. В. ; Leonov, Sergei V. / Леонов С.В. ; Veraksa, Aleksandr N. / Веракса А.Н.

Author Affiliation / Основное место работы автора

Lomonosov Moscow State University / Московский государственный университет имени М.В. Ломоносова (МГУ)

Country / Страна

Russian Federation / Российская Федерация

Categories / Рубрикатор

Neuropsychology & Neurology / Нейропсихология и нейрология

Publication Type / Тип публикации

Journal article/ Журнальная статья

Source / Источник

National Psychological Journal / Национальный психологический журнал

Age Group / Возрастная категория

young adulthood (18-29 yrs) / ранняя взрослость (18-29 лет)

Release Date / Год публикации

2015 - 2019 ; 2016

Pages / Страницы

115-126

DOI Number

10.11621/npj.2016.0314

Language / Язык публикации

Ru

Quotations / Авторские цитаты, отражающие содержание работы

…Многие ученые сходятся в том, что дофаминергическая система играет важную роль в формировании когнитивной сферы человека. В настоящее время проводится все больше научных исследований, посвященных изучению генетических основ поведения, важную роль в котором играет дофаминергическая система мозга. Перспективными кандидатами для изучения генетической природы поведения являются гены, кодирующие ключевые белки, участвующие в передаче дофаминергического сигнала, синтезе дофамина, его высвобождения в синаптическую щель…

Возврат к списку

There are new articles from the «Moscow University Psychology Bulletin»/ Новые статьи «Вестника Московского университета. Серия 14. Психология»

30.03.2015

We are glad to inform you that the new issue of the journal "Moscow University Psychology Bulletin" - 1, 2015 - was released. Carrent Issue: http://msupsyj.ru/en/articles/volumes/2015_1.php

Мы рады представить вам первый номер «Вестника Московского университета. Серия 14. Психология» за 2015 год. http://msupsyj.ru/articles/volumes/2015_1.php

There are new articles from the «National psychological journal»/ Новые статьи «Национального психологического журнала»

30.03.2015

We are glad to inform you that the new issue of the journal "National psychological journal" - 1(17), 2015 - was released. Carrent Issue: http://npsyj.ru/en/articles/volumes/17_2015.php

Мы рады представить вам первый номер «Национального психологического журнала» за 2015 год. http://npsyj.ru/articles/volumes/17_2015.php

About / О проекте New / Новое All material / Все материалы News / Новости Contacts / Контакты
© 2012 — 2018 Psychology. Online abstract digest of psychological sciences

/ ПСИХОЛОГИЯ. Реферативнй интернет-дайджест психологических наук